Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ633283
Length 386 bp
Fasta Format > whdp14i06
gcagcatcttccccctccagaacgtgtacgtccgcaaggtgaagatcctg aaggcccccaagtttgacctggggaagctcatggaggtgcacggtgacta caaggaggatgttggtgtgaagcttgacaggcctgctgatggagatgagg tgattcctggagcggaggaggttgctgctgctgagtagaaaatagaagtc gctattttgctgcttcatatctagaagatgatatatgtgccacctgggtg tcgtgaactttgtagtcagttttgatggctgatttcttgagtacttctgt cgacattcctagccagcgttcagttatcttattttgttcgtgttactttc tggatggaggttatgagtttaaaactaaaaaaaaaa
Download
page-top