Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ632960
Length 634 bp
Fasta Format > whdp13f10
agttgatgcctgcccaatcagggcaatgaagttctctgtgtcccctgttg tgcgtgttgctgttcagtgcaaggtggcctctgatcttcccaagcttgtt gagggtttgaagcgtctggcaaagtcagatcctatggttctctgtaccat tgaggagtctggtgagcatatcattgctggagctggagagcttcaccttg aaatctgtttgaaggatcttcaggatgacttcatgggtggtgctgaaatc attgtttcccctcccgttgtctccttccgtgagactgttctggagaagtc ctgccgtactgtcatgagcaagtccccgaacaagcacaaccgtctttaca tggaagctcgccccttggaggagggactggctgaggccattgatgatggt cgcattggcccacgtgatgatcctaaggtgcggtccaagatcctgtctga ggagtttgggtgggacaaggatcttgccaagaanatttggtgctttggac ctganacnactggccccaacatggtcgtcnacatgtgtaagggagtgcan tatcttaatgaaatcaangactctgttgtggctggnttccantgggcgtc aaangaangcncnttnnntganganaacatgcnt
Download
page-top