Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ632861
Length 473 bp
Fasta Format > whdp12p06
ggaccgtcgccctccgggagatccgcaagtaccagaagagcacggagctg ctgatccgcaagctgccgttccagcgcctggtccgcgagatcgcgcagga cttcaagaccgacctccgcttccagtcccacgccgtgctggccctccagg aggcggccgaggcgtacctcgtcgggctgttcgaggacaccaacctgtgc gccatccacgccaagcgcgtcaccatcatgcccaaggacatccagctcgc ccgccgcatccgtggcgagagggcctaagccgtcctccccgtcaacgccg ttagtggatcggaagtggaatgtgttgcttccggttgtagtttgttccta attgccgtgctaggtctatcttcttctgtgtagaagaaatatggttgttg gagtaagacgaacttgatatgtgatgatgttccttctggtttgcgatgaa gcaaacgtatgtttatgatgcag
Download
page-top