Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ632860
Length 653 bp
Fasta Format > whdp12p05
acctcccccaaatccgcagcagtcgacaggaggccaagccaccgcgatgg cccgtacgaagcagaccgcccgcaagtccaccggcggcaaggcgccccgc aagcagctcgccaccaaggcggcgaggaagtcggcgccgaccaccggcgg agtgaagaagccccaccgctacaggcccgggaccgtcgccctccgggaga tccgcaagtaccagaagagcacggagctgctgatccgcaagctgccgttc cagcgcctggtccgcgagatcgcgcaggacttcaagaccgacctccgctt ccagtcccacgccgtgctggccctccaggaggcggccgaggcgtacctcg tcgggctgttcgaggacaccaacctgtgcgccatccacgccaagcgcgtc accatcatgcccaaggacatccagctcgcccgccgcatccgtggcgagag ggcctaagccgtcctccccgtcaacgccgttagtggatcggaagtggaat gtgttgcttccggttgtantttgttcctaattgccgtgctangtctatct tcttctgtgtanaanaaatatggttgttggagtaanacnaacttgatatg tgatgatgttccttctggtttgcnatgaancaaacntatgtttatgatgc ana
Download
page-top