Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ636628
Length 654 bp
Fasta Format > whdp6j20
ctcctcctaaaccactctccctatccccgtgtccagaatctaccccccgg ctccaatggcggcgaaggaaccgatgcgcgtgctcgtcaccggcgccgca ggacaaatcggatatgctcttgttcccatgattgccaggggagttatgct tggtgcagaccagcctgttattctgcatatgctggatattgaatttgctg ctgaagctcttaaaggcgtcaagatggagttgatcgatgccgcatttcca cttctcaagggagttgttgcaacaactgatgttgttgaggcttgcactgg tgtgaatgttgcggttatggttggtggattccccaggaaggaaggaatgg aaaggaaggatgttatgacgaaaaatgtttcaatctacaaagctcaagca tctgctcttgaagctcatgcagcccccaattgcaaggttttggttgttgc caacccagcaaacaccaatgctctcatcctgaaggagtttgctccatcta tccctgagaagaacatcagttgtttgacccgcctagaccacaacagggca ctcggtcagatttctgagagacttggtgtccaagtttctgacgttaagaa tgctattatctggggtaatcactcgtccagtcagtatcctgatgttaacc atgc
Download
page-top