Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ636099
Length 532 bp
Fasta Format > whdp4k23
ggtaagagcctacaattcatgctgacagtcgagccagagaacgaaaaaat gaagcagaaactggaatgggctcaaaagcagcgtgaagcaaatcaaccga cggttccctcaactataggagatgagcttgagataaacaccttcatgcgt gttgatctgcctgaaatacaggcaaaatttggtgccaagtcggcagttga agcgctgaggacggtcaggaacatcaaggatacctggaaaggttgataaa cgcagctgccactcatacttgtaggtggcgtttacagccgtgcgatgctt tgagagctacgtacgtgttaagaagataatatgccagtgtttcctttaag aaaaacataagagaaaggagtccagtctgctaatatgctttggtatcaat cagaatacaactgttgtggcatgttaattactactggtatgttatttctt ggcaaaacaaacaaaaactatgttggcctgtggcagaatgtcttgtgtat atctgaagtctgtgatggttggaaaaaaaaaa
Download
page-top