Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ635012
Length 611 bp
Fasta Format > whdp1l17
actctccctatccccgtggtccagaatctaccccccggctccaatggcgg cgaaggaaccgatgcgcgtgctcgtcaccggcgccgcaggacaaatcgga tatgctcttgttcccatgattgccaggggagttatgcttggtgcagacca gcctgttattctgcatatgctggatattgaatttgctgctgaagctctta aaggcgtcaagatggagttgatcgatgccgcatttccacttctcaaggga gttgttgcaacaactgatgttgttgaggcttgcactggtgtgaatgttgc ggttatggttggtggattccccaggaaggaaggaatggaaaggaaggatg ttatgacgaaaaatgtttcaatctacaaagctcaagcatctgctcttgaa gctcatgcagcccccaattgcaaggttttggttgttgccaacccagcaaa caccaatgctctcatcctgaaggagtttgctccatctatccctgagaaga acatcagttgtttgacccgcctanaccacaacagggcactcggtcanatt tctganagacttggtgtccaagtttctgacgttaagaatgctattatctg gggtaatcact
Download
page-top