Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ634936
Length 507 bp
Fasta Format > whdp1g23
cagggcactcggtcagatttctgagagacttggtgtccaagtttctgacg ttaagaatgctattatctggggtaatcactcgtccagtcagtatcctgat gttaaccatgccactgtgaagactcccagtggagagaagcctgttcgtga acttgttcaagatgatgaatggctaaatggggagttcattgccactgtcc agcagcgtggtgctgcaatcatcaaagcgaggaagctctccagtgctctc tctgctgccagctcagcttgtgatcacatccgtgactgggttctgggaac cgctgagggaacatttgtttccatgggtgtgtactctgatggttcatacg gtgtgcctgctggtcttatctactccttcccagtaacgtgcagtggtggt gaatggacaattgttcaagggctcccgatcgatgagttctcgaggaagaa natggatgcnaccgcccagagctgtcanagganaangcgttggcctactc atgcctg
Download
page-top