Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ634916
Length 460 bp
Fasta Format > whdp1f18
gctcgtgtatactgctgtggtcaccctgtcttccagcagggcaatcagac attcctaggtcaagcacagtgaaggtgttttgtccaaaatgtgaagattt acactatccaaggtccaagtaccaaggcaacattgatggagcatactttg gtacgacattccctcatctcttcttgatgacatacccacacctgaaacca cagaagccatcacagcaatacgtcccaagggtttttggcttcaaacttca caagcagtcatgacgaacttttaccagcgggcgctatttgtttttaccta gtgttagagatggaacaccttggcctgaaaatgttgtggcctcttgattc gagtactcgcgagctcgaatcttgctgtaaactgctgagcaactgtatct gttttgttgtatgactcttgtgtaatctaggtttcctcacttgatcaatc aaaaaaaaaa
Download
page-top