Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ634835
Length 573 bp
Fasta Format > whdp1b03
accttacaagcaaggtggggacaataggcagttcttcatgtatatccttc ttccagaagcaccaggtggtctctcaagcttggccgaaaaattgagtgct gaaccagacttcctggagcggcatatcccaaggcagagggttgcacttag gcaattcaagctccccaagttcaagatatcatttggaattgaagcatctg atttgctcaaatgtttgggcctccagcttcccttcggcgatgaagcggat ttttcggagatggtggattccctaatgccacaaggtcttcgtgtctcatc tgttttccaccaagcgtttgtggaagtgaacgaacaaggaactgaggctg cagcatcaactgctattaaaatggtcctgcaacaggcaaggccgccctcg gtcatggatttcatcgcggatcaccctttcctcttccttgtccgggaaga catctctggtgtggtcctattcatgggtcatgtggtcaatcccctcttat cttcgtaatgtgtttgctctgaaagtgtgtgttgncanntgccctcancc attatatgnaagggaanggnttc
Download
page-top