Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ632040
Length 403 bp
Fasta Format > whdp10b23
acgaatcctctccgaccaagaagagaagagaagagaagggaagagaagag agatgggagggttccagcggcaggtgaaggagcggaccatggaggtgaag gtggcggtgctcaagggcgtcagggtcgtcggcgacttcggcaagaagac gtggaacaaggtcaaggccatcaagcgctgatcgatccatccatcgcatc accccggccgtctgcttcccttcgctccagtccaatagttgcttcatgta gtactgcctgataggatagccgtctggcctcgctctctttttctcggttg tggttgtgatttggtttgttggatctgttttgaggcaacttttgatgcat gtgaaaattcgcctgtcagcataggcttatatttagccttcttaaaaaaa aaa
Download
page-top