Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ632039
Length 615 bp
Fasta Format > whdp10b22
agttttgcaacaaagtacttaccagctattgcaacaattgtgttgtcaac aactgttgcagatccctgagcagtcgaggtgccaagccatccataatgtt gttcatgctattattatgcatcaacaagaacaacaacaacagttgcaaca acaacaacaacagcaactgcaacaacaacaacaacaacaacaacaacaac aacaaccgtcaagccaggtctccttccaacagcctcagcagcaatatcca tcaagccaggtctccttccagccatctcagctaaacccacaagctcaggg ctccgtccaacctcaacaactgccccagttcgcggaaataaggaacctag cgctacagacgctacctgcaatgtgcaatgtctacatccctccacattgc tcgaccaccattgcgccatttggcatctttggtaccaactgagaagagaa gaactctagtactagatatatgaaacaccgttttcttagtccatgatttg gtcgttgtagcagtgaaaaaataaagtgacatgcactatcatgtaagaac ccgaactatactagttcaaacttgggaataaaagacaaacacatgtcttg tctacaaaaaaaaaa
Download
page-top