Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ632032
Length 590 bp
Fasta Format > whdp10b14
tgggtactacaacttacatgatagagatggctacagacccatagcacgca tgctcaaaaggcaccgtgctagtcttaacttcacttgcgccgagatgagg gactcggagcaaagctcacaggccatgagcgcaccggaagaactagtcca acaggtgttgagtgctggatggagagagggcctaaatatggcatgcgaaa atgcacttcctcgatatgatccaactgcttacaacaccatactcaggaat gcaaggcctcatggcatcaacaagagcggccctcctgagcacaagctgtt tggattcacctacctccggctgtcgaatcagttggtggagggacaaaact atgtcaatttcaagacctttgttgacagaatgcatgccaacctgcctcat gacccatgtgttgatccagtggcgcctttgcaaagatcagggccagaact gacgattgaaatgatcctacaagcagcgcagccaaaactggatccattcc cctttgaagagcacaccgacctgcgagttcaaggcctcggtggcatcggt ggggatgttgaaggccccactggtggcatgggtggggagg
Download
page-top