Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ632031
Length 506 bp
Fasta Format > whdp10b13
ctgccgatgtggttaatgcacttgtgaaagatacaaatgagctatctttt gttgatgctgttgcgaagccagttactgtctcagatttgacaaaggatgg ttcaggcacaaagcaaagcatcatttgagcttgtgtgttgcatgagattg aacatttgttgggcgatttgtgctgtgttagtgcgctcccattctcccat tcagaattctgagcctgatgcctatttttatgagcgcgttgaaattcact gcttgctattttctacatgcaagtccgagtagggtcttgagttttcgtca tttgtgaagtaccacttcggttttagtgtgacctgccatatttctttgta ataattttgttcttaatgtttgtttagtctcgtaacaataatagtatccc tataggaagaagccttccgtgttctcacagttctgtaatattcattctat tgccgtccattacagtggctgttatgcatttcaacttttggtcctcaaaa aaaaaa
Download
page-top