Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ632026
Length 542 bp
Fasta Format > whdp10b07
tcccctcgtcggcgcccgatctaaggtcaagatgagtcgtggcgggagtg ctggaggtggtcaaagttctctgggttacctgtttggagatggtgagcct gcaaagcctgctgcagcaccagctgcgaagccagcacctgctgagaaacc agcactggcagctgccgatgtaaccaagcagattccagctggcattccag gtagccgggcgaacaactactaccgtgcagatggccagaacacgggcaac ttccttacggaccgtccttcaaccaaggttcatgctgctcccggcggtgg ctcgtccctgggctacttgtttggcgggaagtgatctctgttaatgatgc tgcgatgaattggcctgtatctctgttatccatgtggtgaaaactggaag tgtttggtttcagcagtttaccacctgcgtcgatgtactctgtctgtatg gttcattgtgtccangctgacctcctgcttggaagccancttgcctaaaa cctgtcgctttcaaactaatcgtcttcatctcaaaaaaaaaa
Download
page-top