Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ632013
Length 587 bp
Fasta Format > whdp10a09
gaccgaggccgaggggaacgggaccgcatcgattccactccggaatcaag ccgcagagaggggcagccggttccatccagtgaagaccgccggggtgcgt cggttaacctgaggtcagggatgggatcgagtccatccagtcgatcgcag cgaccggaggagcgggatccaggtcaagctgagtccatccggtcgatccc agcgaccggaggagcgggatccgcgtcgagccgatccaatccagcgcgtt gtagaggtgtgctacggagtcaaggtgcgggggagggagataatggcaga cgcctcgcgtactggtcaggaagaccgtcttactttgatccttgggcagt gtgactgatcggtagatcaacatcaaagttttgatgatctatgattgttt acgtgttcaaggtcttgtgtanttgtctgcttgatctggtagtatgacac ataaaatattaaggcatgtgaaatgtttgatagtcacttgaagctgattt tgcgtaaagtcaagagtgaccttttgttttatgagttttcaaaggantct gttataatttatataattattatttttaaaaaaaaaa
Download
page-top