Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ632012
Length 238 bp
Fasta Format > whdp10a06
gatcatccctcattctgcgtgtgcccatattatatactccgctatataat gtcacatatgtgcgtgcgtgcatggccggtgcgtgccattcagcgaataa atgtataaataanatggaagtgtaatttctacggntatgtggagtgcaac tctgtttnattttcttatctttttatgccatgaatattgctacatctatg gaaaatttcttacgcacagaattccctgaaaaaaaaaa
Download
page-top