Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ521479
Length 759 bp
Fasta Format > rwhcs2g17
tgctttgatccctcatcttcatacttgtaggagcaaatattctcttacat gacagtattttattaatgctctattggtggaaaatcaccgagtcgcaaac acggggatacgttgcaaagaggcaaaccatttcttttgcagggggaagct agacttacggaccctgtgttttcccagtatagcattctggagttcatgtc gtcttcataaaagtggaacctaggatgatgatgatgtcttgccatccaac gtcagtagcactttgtatagatcaggacgcctgtccctgaatatccccca gccgtgtctcgtagatttgatctcgtccaagtcaaactctgccacgagca cctcctcgtctttgtcatttgcaagcttcacgatttctccagttggccct gcgatgaatgagttcccgtagaattttatggtgctgttcccatgctcagt ctcgacagtttcctttcctatccggttagaagcaacaagaggaaccaagt tagcaccggcatggccttgcatgacacgcttccagtgttcgcgggaatcc aggttcatatcctggggttcagaaccaatagcagtgggatagaacaatat ctccgccccctgtagcaccatagcccttgcggtctctggaaaccactggt cccaacaaattccaacaccaattgttgcatacttggttttgaaagccttg aatccagtgtcacccgggttgaaataaatttctcttgataacctggtcca tctggaatg
Download
page-top