Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ293494
Length 456 bp
Fasta Format > whsl16k22
ccttcgccctcctccttcccatttcgccagcggcgcagcccaccaaccac ccccacccgccgccatgagggagtgcatctcgatccacatcggccaggcc ggcatccaggtcgggaacgcgtgctgggagctctactgcctcgagcatgg cattcagcctgatggccagatgcccggtgacaagaccgttgggggaggtg atgatgctttcaacaccttcttcagcgagactggtgctgggaagcatgtc ccccgtgctgtctttgtagatctcgagcccactgtgattgatgaggtgag gactggtgcttaccgccagctcttccaccctgagcagcttatcagtggca aggaggatgcanccaacaacttcgcccgtggtcattacaccattggcaag gagattgttgatctgtgccttgaccgtatcaggaagctttnagacaacct gcactg
Download
page-top