Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ521350
Length 609 bp
Fasta Format > rwhcs20p06
tgatggncatcataatctggagcttcttgatgccatntccaacgggcatg agcttggaagcaccccacanaaggncctccatcttgatgcttcngacagc ttcctccagcttgaccatgtcgggctcatcgncccatggcttaacatnaa gcaaaactgatgacttgccagattctttcttcttggtagaagcctttgct ttggcagcgcgctcttcagctgcctttttctcctcctcggtttcctctcc aaaaaggtcaacatcgctgtcatcgtcatcatcanctgcaggagcctcag caacatcagtagttgaggtttcagggacaactgatgacagaaccttcaca ccttgaccaggggcagtaactccactcagcttcaggagtgcatcaatgtg attgtaccaccttgcaacattggtgcaagttgatggtggagcaactgaga actctgaatacacagccaagtcatccttggaagcttggtatccagagatg taactgcgagacagaangtagccatcaagctttttaaggcctgcctcanc attaacattgaaggtanccgccatctcancctcaaaaggatggaacagat gatctactc
Download
page-top