Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ521202
Length 554 bp
Fasta Format > rwhcs20f21
accacaaacagctagccgcgccttaatgtttggccagccanaagacaaaa ccgatacagcgaccatccaacgatcgacactaaagataaaaacaactagg cggtgcagggcatgaacatccgacgacaggcagacttggcgcttagtcga cctcctccatcttgctctcaccagcgtngtcctccaggggcggcatgtcg gtgtcgttctcaggcgcctcatcgncctcgtcaatgctcaggccaagctt gagcatgcggtggatcctggtgccgaaggtgttggggtcctccaggctga agccggaggtgagcagggaggtctcnaanagcagcatcaccaggtccttg actgacttgtngttcttgtcngcgtcggcgcgcttgcggagctcgtccat gatggngttctcagggntgatctccatggncttcttgcttgacatgtagc cagccatgctcgagtccctcnaggcctgggccttcatgatcctctccatg ttggcggtcnacccatacctcgccantcaccagacngccanggggagtcc acaa
Download
page-top