Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ520847
Length 910 bp
Fasta Format > rwhcs19p09
agatatataatctaagttttaacatcgatagacatcaaaacaaagtgata ggacatcccaatagcaatacagccacgactcaacagacagaaaataatag tgcagctctcttagcagcaaaagcaaactagacccatatgataacagaac taaaagtttagagcttgtcctcgaaatcagatagaggggtcatctgttcc ttcagacccttgcgcttgcggatctccgtgacaagggtcgcagactggga gccggcctccaaaggatccgaagacatgatgtcccagtggtcgaacacac actgggggaaagcctggccagatgtcgcagccctgagggtacttgagaac ccgaacgactcgatgaccgggaggtaagccttgatgttgtacagcggggt accaggcctctgcatctcctcaaacacgtgccctctcttctgattcagaa caccatagataccgccgagtgcattctccggggcctggatctcaaccagg tacacaggctccagtagccttggcttagcagtgagctgagaagcataaat gaccctccgggctgttgggatgacctgaccaccacccctgtgaatagcat cagtgtgcagaacaacatcacagacctcaaagcagatgccacgcatgttc tcctcagccaatgcaccttccttcgatgcccactggaacccagccacaac agagtccttgatttcattcagatactgcactcccttacacatgtcgacaa ccatgttgggcccagtcgtctcaggtccaaagcaccaaatcttcttggcg agatccttgtcccaaccaaactcctcagataggatcttagagcgcacctt taggatcatcacggtggggccaatgcggccatcatcaatagcctcagccc aatccctcct
Download
page-top