Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ520116
Length 704 bp
Fasta Format > rwhcs17c02
agccatctaacgatggtgctccttacaaagtttcaacacaagggtaacaa gcatacacgcagagaggtgggctatgctagattttccgtatactcagagc gcgcaagctggtaacgcctgcttgcgctagcacacaactaaatatactgc accaccaatatatagctgctttgcatgtagactctgatatggagctggca gttgttcagaaaccatgaatcttgatgtgttccttcttcacaatgccggc ctggacaaggaagtttgagacgttcttcctctgatcaccctggagttgaa tgacctgtccaagttctgtgtcctggacaactgtaccattgcagcaaaac tctttcttgaggtctttgaggatcttgctgtagctgaactccttcttcag gccctggacagtggtcaggctcttgcgaccattacgctgctggatgcgta catgaacgtagtcttttgatccggcagctgcaccagcgtccccagcattc gcctcggcaaaggggtcaaaggcagttgggatctgaacgtcaagatcaga catgaaatctcctggtgagagtggcaaaagctacaccaagaacctgggag gcggtcgaggaggaagagatcaaccaagaactttcccgggaggatttgga tcgcggagaggcgctggcagtcagtccttggtgttcttcctcctctttgg gttg
Download
page-top