Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ519986
Length 719 bp
Fasta Format > rwhcs16k01
gatctcgatccattgatgtattcgggggttgtgccgaagaanaagatata gacctatgaggaattacgtatgcatgctcannaacctatgttcgtacata catacacnaaatcatatagaacaaaaggtatgctccggtcngaaagcana gtcgtacagcagagttttggacaaaagtgaagttcacaaaagaccttcat acganataggccattgtttcaactcntagtttaggccttgccggactcct cncaacccggtggcctaaaggcgatgaagctgacgcactgcacctggcgc angttgtcgaagccgatgacacggacataggcgtcagggtactccttctt gacctcctccncctcgttcagcacctgtgtggcgtcagtgcacccgaaca taggcagcttccacattgtccagtatcggccgtcgtactacccgggggag ctgttgtgctcacngaagacnaanccaaccttgctgaactcgaggcaggg cacccactttgagcggatcaggtagtcgacctgtttcangagggcctccn tggatangggtggcaggtaagacagggtctcgaacttcttgatgccctca nttggccacacctgcatgcacctgatccttccgccattgctgacnctgct gaggctgccgctggagcggcggccgacggggagaccggctgtggacttga ncccctggaagggtgcgac
Download
page-top