Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ519886
Length 912 bp
Fasta Format > rwhcs16e16
attctggcattacaacatatagcggcaagaaaatactacagacaaatgat actaggtccactaggataatgggaaacacggggatacagtcgtctagaca cgcggcagttgcatcagaccattttgtggctcaaaaagtttctaatcgtc accaaatgtggtcttcttccctgcgctagctgtgccagcactctgtctgc tctgaaagcctcggccgcctcctctgccgccatcacggccaccagaccgg ccaaacctgccgccaccatcacggccaccagaccggccaaacctgccgcc gccatcacggccaccagaccggccaaacctgccaccaccagagcggccac catctctgccaccagatcgaccaccaacgccaccaaattgacccttaggc ttagcttcagcaacatacaagttgcagccacctaggtcagatccactaag ctcaagtgctttcgaaaaggaactctcatcagtaaaatccatgtaagcta tccctttgcttgcaccattctcataatccatcggaactgagacacgtgtg atttctccacatttagagaagtgttcttgaagagagctccgaatagcatc ctcctgttgagatgaatcaaaacccttgacaaatactgagaggctgggac ctccacttggttttccaaacgatccaccatccctggtgcgaggagttgca cctctttcagcagccatgtcaagtctcaccggacggcccattagatctcc accattcagtgaatcaagcgctttctgagcatcttcagccgtagcaaact caacatgaccaaatcccttgggatggccatcttcatgggtagccaggcga acatcaacgacctctccaatttgtgcaaaaaattgcttcacttgatcata ctcaatattgaa
Download
page-top