Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ519698
Length 870 bp
Fasta Format > rwhcs15j13
aaaagtccaacgcagattaagcctggggtgtttttcgcggtgtgtttcaa gtggacattagggttttcctgctcattccggtgcgctagtgtgtgcggtc gatggcacttgacaaaaagtagtagggcctagtccttgcctgccgatcgc tataccgaagaaaactacctgcgcctgcgtctcttgccggtttcgtccat gaaggactcccaaccgtcgtgctccagcttgctgaaatcttctaactccg caatggagagcaggtactgcgtgagctttcgcagctcctgatcgcggcct cggttcttactggcgttcttgaacggtctgatcacgaggccgttctgtgg gttcatgacgaaattcctcctgaggtcatcaaacatgattgtgttctttt cactgtagtgctcggggaacttggtccagatgacaccaagaggtttgcag tcgaagaccttcttgtcaggagcatgcacagttatcatcgccatgtgatc cagaagggcggtgatcttgtagttgggattgctaagaactccaagttgct ccatcttcagctgcacccatttcatatttgttgctgaccatatcatgata tcatactctgcgtatgcagcancgagaaattcntgganaaatggacgcat ganttccaaaggattctcanctggagacctatggtcaaacagantatant caatgtctaacacaancaatctttttccatcncggcatggattcaanagc ttgatcttatactggcttgcacnacntttcactttttgcttgtananaac attatccttgatancannaacttcatctttgaaaaattcataatcatcna ntacctctggaatcatctgg
Download
page-top