Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ519693
Length 925 bp
Fasta Format > rwhcs15j06
tacatatatagtagaattctggcattacaacatatagcggcaagaaaata ctacagacaaatgatactaggtccactaggataatgggaaacacggggat acagtcgtctagacacgcggcagttgcatcagaccattttgtggctcaaa aagtttctaatcgtcaccaaatgtggtcttcttccctgcgctagctgtgc cagcactctgtctgctctgaaagcctcggccgcctcctctgccgccatca cggccaccagaccggccaaacctgccgccaccatcacggccaccagaccg gccaaacctgccgccgccatcacggccaccagaccggccaaacctgccac caccagagcggccaccatctctgccaccagatcgaccaccaacgccacca aattgacccttaggcttagcttcagcaacatacaagttgcagccacctag gtcagatccactaagctcaagtgctttcgaaaaggaactctcatcagtaa aatccatgtaagctatccctttgcttgcaccattctcataatccatcgga actgagacacgtgtgatttctccacatttagagaagtgttcttgaagaga gctccgaatagcatcctcctgttgagatgaatcaaaacccttgacaaata ctgagaggctgggacctccacttggttttccaaacgatccaccatccctg gtgcgaggagttgcacctctttcagcagccatgtcaagtctcaccggacg gcccattagatctccaccattcagtgaatcaagcgctttctgagcatctt cagccgtagcaaactcaacatgaccaaatcccttgggatggccatcttca tgggtagccaggcgaacatcaacgacctctccaatttgtgcaaaaanttg cttcacttgatcatactcaatattg
Download
page-top