Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ519674
Length 869 bp
Fasta Format > rwhcs15i04
caatgtctgcatttagccagttgggtacaattcagcaggaccagacattg catggactactgaccatctagctgctggaccagaaaactctactaccatc aagacaaaacataagccaagaattcatagtctaaataagcgctcttgcca gcggataggcgatactcaaacaagcaaagtatgttgctagcttagcaaaa gaaatggcaatgatgtatcacgatcgaaacatatcagctacagatagcac cttgatcagcttcagctatcaaatgggtcactcttggagagattggacgc tgcgcggaagctccaatcactgcccccactgctgcgcaccaagattgaga atttcgagtctctgctggcacgcttggtgctgcaagccaaagttttcagc ttggccgccaccctctcctctgaagcagggtctccatctgccaacacgac caccattttttgcagaagctgtgctctctccacgacgaacctgaggaaca cgacctcgctccggttccctcggaagttcttgaacaccaccttcttggtg tgtgactgcaggcattcgatgggtccgacatcatgccagaacttgaaatt cagcttgccagtgggctcatcagcttcagcagacatgacatgcaatgttt cgacattggggaagcatctgaggaaggtaggcagcaccttagcctctttg cgcactccaaatcgcacccttaacgccaggatcttgagacttggaatggt ggtcgtggggctgggccttgtgccaaactcgatgacggtgttgccgatct cgagcacatgaaagcttggctccaagtagccgagcaccttgagctccggc gcgtagccaatcttgactc
Download
page-top