Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ519490
Length 933 bp
Fasta Format > rwhcs14n15
gattctggcattacaacatatagcggcaagaaaatactacagacaaatga tactaggtccactaggataatgggaaacacggggatacagtcgtctagac acgcggcagttgcatcagaccattttgtggctcaaaaagtttctaatcgt caccaaatgtggtcttcttccctgcgctagctgtgccagcactctgtctg ctctgaaagcctcggccgcctcctctgccgccatcacggccaccagaccg gccaaacctgccgccaccatcacggccaccagaccggccaaacctgccgc cgccatcacggccaccagaccggccaaacctgccaccaccagagcggcca ccatctctgccaccagatcgaccaccaacgccaccaaattgacccttagg cttagcttcagcaacatacaagttgcagccacctaggtcagatccactaa gctcaagtgctttcgaaaaggaactctcatcagtaaaatccatgtaagct atccctttgcttgcaccattctcataatccatcggaactgagacacgtgt gatttctccacatttagagaagtgttcttgaagagagctccgaatagcat cctcctgttgagatgaatcaaaacccttgacaaatactgagaggctggga cctccacttggttttccaaacgatccaccatccctggtgcgaggagttgc acctctttcagcagccatgtcaagtctcaccggacggcccattagatctc caccattcagtgaatcaagcgctttctgagcatcttcagccgtagcaaac tcaacatgaccaaatcccttgggatggccatcttcatgggtagccaggcg aacatcaacgacctctccaantttgtgcaaaaaattgcttcacttgatca tactcaatattgaaggaaanggttccccatcca
Download
page-top