Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ519438
Length 754 bp
Fasta Format > rwhcs14k12
ttcacagatatgcctcgacataaaggttctagcacaagcttcaagtagtc tcagaacgaaggtagcaaaacctgatggctcaaacaaaatactatcaagg tgtgcatagggcagcttaacggtagcggcggagggagacggtctggttgc gcttccaggtggctctccttgagggcctgttcttgtggtggcggtggccc ttgccacgcagaccacggaatttctttcccgccgacgtgagtccgcgaag ctcacggtgcttgtgcacgggcttgcagagccagttgatccttgggtcgt tgcggacagcactgtgagcaacatcaacaaggatgacctcaaagtacttg taggtagagtcctcattcacccagtaggagttgagcacacgaagaccacc cagcctgcgcccagctctttcttcagcaacagacctcttgttcctctgga acttgagctgggtaataccctggtgcttgggcttaccatagacaataccc ttgggcactggcctcttcctgccaccacgcctgacacggatacggtagac cacatacccctgcttggccttgaagccgagacggcgagccctgtcggggc gggtgggcctggtgatgcgcacgatggccggctgctgcctgtactcccag caacgcacgcgctgcacgaacctcatcacgtccgactgcttcctcctcca tagctccgacacgaacttgtacgcgcccatggctgcggctgcngctgcgg cggc
Download
page-top