Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ519432
Length 657 bp
Fasta Format > rwhcs14k01
cagatggtgctatctcacatccacgtggcaactgaaaggactcccgtcac aaacctacagttcacaactccctctaagatttttacaaaagcatttcctc tgctgatcttcggaggctaagatgctggcctatgctttaagttaggagta atcactacggccgaatttcctacttgataaccccctaacttgctagttga caaccaaacaccatacacatcttgattcaaaaagatccagcttatcctac tacatcccagggcaacaagtttaccagagcacaaccgtgcatgcaggact cgtcttcctggggaagaattgatgatcagatcttcagatctttcttgcag ttatctctcaagtcctttaacttgacaacagctgaatggagctgggcaga ttcacgaacaagggcattttcagtatgaagaaagagtgatctctgttgtt gagatagttcgaatcccatctctgcagctcttttcgagtatctgtctgca ttgaattcatttccttgcctctttgcctctagcgatctagcaaactttat gctcttcttcaatgcaccaagccggcttcttgcatcctgataatggagat cagtccacataaaagcagccttaagacagaaagagcaagtgcaagacttt gtagcac
Download
page-top