Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ519314
Length 855 bp
Fasta Format > rwhcs14c23
actgttccacgagtaccacaaacagctagccgcgcttaatgtttggccag ccaaaagacaaaaccgatacagcgaccatccaacgtcgacactaaagata aaaacaactaggcggtgcagggcatgaacatccgacgacaggcagacttg gcgcttagtcgacctcctccatcttgctctcaccagcgtcgtcctccagg ggcggcatgtcggtgtcgttctcaggcgcctcatcgtcctcgtcaatgct caggccaagcttgagcatgcggtggatcctggtgccgaaggtgttggggt cctccaggctgaagccggaggtgagcagggaggtctcgaagagcagcatc accaggtccttgactgacttgtcgttcttgtcggcgtcggcgcgcttgcg gagctcgtccatgatggcgttctcagggttgatctccatggtcttcttgc ttgacatgtagccagccatgctcgagtccctcaaggcctgggccttcatg atcctctccatgttggcggtccacccatactcgccagtcaccagacagca aggggagtccacaacacggtcagagacgatgaccttctccaccttgtcgc ccagcacctccttgatgaccttgcacagcccctcgaacttctccttgagc tcctcctgcttcttcttctcgtcctcgctctcatcgagcttcanaccctc cttggtggcanagacaagcttcttgccctcaaactccttgagctgaccaa tggcatactcatcaatggcgtcaaccatgtanatgacctcatancccttc ttcttcancttctcaagggaangganagttctccacanccttcttgctct caccg
Download
page-top