Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ288545
Length 669 bp
Fasta Format > whsl15b11
ggtggtggcggcagcagcaggggcagaaggcaaaggaggggagaggatgt tgtccatccacttaaagcttctctagaagatctttacaatggtacctcga agaagctctctctttcccgtagtgtcctctgctccaagtgcaagggcaag ggatccaagtctggtgcttccatgaggtgcccaggttgccaggggtcagg catgaaagtcactattcgtcagctggggccttccatgatacagcagatgc agcaggcctgcaatgattgcaagggcaccggggagagtattaacgacaag gatcgctgcccaggctgcaagggtgagaaggttcttcaggagaagaaagt tctggaggttcacgttgagaaggggatgcaacacaaccagaagatcacct tccctggtgaagctgatgaggcgcctgacactgttactggagacattgta tttgtcgtccagcagaaggaacacccgaagttcaagagaaagggcgatga tctcttctatgagcataccatatctctcactgaagctctttgtgggttcc aactcgtcctgacccatctggacaacaggcagctgctcattaaatcaaac cctggtgaagttgtcaagcctgattcattcaaggcaatcagcgacgaggg gatgccgatgtaccagagg
Download
page-top