Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ519010
Length 711 bp
Fasta Format > rwhcs13b18
caagccatctaacgatggtgctccttacaaagtttcaacacaagggtaac aagcatacacgcagagaggtgggctatgctagattttccgtatactcaga gcgcgcaagctggtaacgcctgcttgcgctagcacacaactaaatatact gcaccaccaatatatagctgctttgcatgtagactctgatatggagctgg cagttgttcagaaaccatgaatcttgatgtgttccttcttcacaatgccg gcctggacaaggaagtttgagacgttcttcctctgatcaccctggagttg aatgacctgtccaagttctgtgtcctggacaactgtaccattgcagcaaa actctttcttgaggtctttgaggatcttgctgtagctgaactccttcttc aggccctggacagtggtcaggctcttgcgaccattacgctgctggatgcg tacatgaacgtagtcttttgatccggcagctgcaccagcgtccccagcat tcgcctcggcaaaggggtcaaaggcagttgggatctgaacgtcaagatca gacatgaaatctcctggtgagagtggcaaaagctacaccaagaacctggg aggcggtcgaggaggaagagatcaaccaagaactttcccgggaggatttg gatcgcggagaggcgctggcagtcagtccttggtgttcttcctcctcttt ggctctctctc
Download
page-top