Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ523398
Length 387 bp
Fasta Format > rwhcs9m05
gancttacgtgctctcagttctttcntggnaatctcnanaggatcagttt cnccntcaagntcaaccataactggggcattcatgcttatctgcaaagca cgtgtgccaaggatgcgtgcccgctcatacttggtcatatattttgttgt attgcgtggacgggcagtcttttcctgttccttttcttcaccttcacccc ctaccacgtcatcaggggcatcctcgttgttctcaggatcttcttcaacc ccttcctcaatatcagcctctggaggctcatcctcntaccccatgtcaac ttcattatagtcgtcgtccgccatggctgccgccgccgagcgctccggtc gctagggtttcgccgcgggaggaancctcgggcgtgg
Download
page-top