Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ523373
Length 717 bp
Fasta Format > rwhcs9k21
attcgccactcagtttacaatacacaccgacaaccgcctcaaaaaccacc aaatcaaagggatgagcacatggcgccgcgccgcgccgagaaacaaacta gcctaaccaacaggtggatacagagacccagattattcaaagtaaacacg gctatggtggcgacatcctccttgcaattaaaatgggggagctgctatac ggcttactgcgccttggcgagctcggcgcggatctgcttggcggcctcga ccatgttggtgagggcgggcttgacctcggcatacttgcgggtcttgaga ccgcagtcggggttcacccacaggatgttggtgtcgagcaccgcgagcat cttgttgacacggtcggcgatctcctccttggacgggatcctgggggagt ggatgtcgtacacgcccgggccaatgccggcgccgtacaccacgccctcg cggaagacggagagaagcttctcgtcggaccgcgagttctcgatggtgat cacatcggcgtccatgttgatgatggactggatgatgtcgttgaagttgg agtancacatgtgggtgtggatctgggtggtgtcctggacaccncanttg ntgatcctnaangantgcacngnccnntcnaantananancatgctccna nttnnnnantgnnanaccctctctcnannnncctcntnnatttnnataan ntnantnnnnnnnnnnt
Download
page-top