Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ522746
Length 806 bp
Fasta Format > rwhcs7f04
attcggacataatatactctaagcaacaaagaacagatatcacaaatggg ggaaaggggagaaaaaaaatcacaatgtacgctgctgcaggtttcgtaga cagtggttctcagcagcatgggcggctaaccaaaggggcaacaattaatt tagataaactcctcccgtcttcatctacaaccaaaaaaatcccatctaac cccctccggtatttacacgaggggggcagatactcttgagcgccgatgat ccgatcagcagttgacgccgcactgccccatggcgacggccttctgggtg tcggatatgaacgggtcgatcttcacccacaggagggagaagatggaggc gaggaggatggaccagacgatgacgatggtcggcgtgcggttctgctttc ccatgagacccttgaggaaggggtagagatggaggatcacccagatcgag aagaagagctttccgaagagcgggccccaggattggtagccgctgttgat ggcgtatgatatgccggccaccatgcccacaaggttgatgaccaggacgg tggtcggagggatcaggagactggtccacttgaacacgtatagctcggcg aagtcgccgtcctcgtcgttcgccttggatgtgacagtgaagttggtgtc gatcccggccagcaccttgagcagaccctggaacaccgcgaaaagatggg cagatgtgccaccgataacccanaactgctcgtttctccaccagtcctcg atgccgacaccactccatcggagctccaatataccagtggcaaaagatgg aggcaa
Download
page-top