Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ522693
Length 860 bp
Fasta Format > rwhcs7c04
acatagttcccagtatcacgacaagtaggtcataacagcaagactcatcg atacaaaatagtgcagctctctttaacaacacaagaccaggtaagggata acagcaccaaaaatttagagcttgtcctcgaaatcggatagaggggtcat ctgctccttgaggcccttcctcttgcggatatccgtgacgagcgtcgccg actgggtgcctgggtccaaaggatcagaagccatgatgtcccagtggtca aacacacactgggggaaggcctggccggacgtcgcggccctcagggtgct tgagaacccaaaggattcaatgacggggaggtaggccttgatgttgtaga gcggggtaccttgcctctgcatctcctcgaacacgtgccctctcttctga ttcagaacaccatagataccaccaagcgcattctccggggcctggatctc aaccaggtacacaggctccagcagccttggcttggcagtcagctgagaag cataaatgaccctcctggccgtgggaatgacctgaccaccacccctgtgg atagcatcagtgtggagaacaacatcacagacctcaaagcaaatgccacg catgttctcctcagccaacgcgccttcctttgacgcccactggaaaccag ccacaacagagtccttgatttcattaagatactgcactcccttacacatg tcgacgaccatgttggggccagtcgtctcaggtccaaagcaccaaatctt cttggcaagatccttgtcccacccaaactcctcanacaggatcttgggac cgcaccttangatcatcacgtgggccaatgcgaccatcatcaatggcctc agccantccc
Download
page-top