Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ522478
Length 910 bp
Fasta Format > rwhcs6f07
gattctggcattacaacatatagcggcaagaaaatactacagacaaatga tactaggtccactaggataatgggaaacacggggatacagtcgtctagac acgcggcagttgcatcagaccattttgtggctcaaaaagtttctaatcgt caccaaatgtggtcttcttccctgcgctagctgtgccagcactctgtctg ctctgaaagcctcggccgcctcctctgccgccatcacggccaccagaccg gccaaacctgccgccaccatcacggccaccagaccggccaaacctgccgc cgccatcacggccaccagaccggccaaacctgccaccaccagagcggcca ccatctctgccaccagatcgaccaccaacgccaccaaattgacccttagg cttagcttcagcaacatacaagttgcagccacctaggtcagatccactaa gctcaagtgctttcgaaaaggaactctcatcagtaaaatccatgtaagct atccctttgcttgcaccattctcataatccatcggaactgagacacgtgt gatttctccacatttagagaagtgttcttgaagagagctccgaatagcat cctcctgttgagatgaatcaaaacccttgacaaatactgagaggctggga cctccacttggttttccaaacgatccaccatccctggtgcgaggagttgc acctctttcagcagccatgtcaagtctcaccggacggcccattagatctc caccattcagtgaatcaagcgctttctgagcatcttcagccgtagcaaac tcaacatgaccaaatcccttgggatggccatcttcatggggtagccaggc gaacatcaacgacctctccnaatttgtgcaaaaaattgcttcacttgatc atactcaata
Download
page-top