Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ521978
Length 865 bp
Fasta Format > rwhcs4f09
gatgtacctgcaactgttttgcaccaaaccacaggactcgatggtccatt aaagcagcagacacagtacgacttcacacaaacgagacatcacttgaaca aaggcgacacagggtacagcagcagcagcagcaggtcaaacgatagggca attactgaccaccacggaggcggagcaccaggtgaagggtggactccttc tggatgttgtagtcggctagggtgcgaccatcctccagctgcttgccagc gaagataaggcgctgctggtccgggggaatgccctccttgtcctggatct tagccttgacattgtcaatggtgtcagagctctcaacctcaagggtaatg gtcttgccagtgagggtcttcacgaagatctgcatgccaccacgcagacg cagcaccaggtggagggtggactccttttggatgttgtagtcggccaggg tgcgaccatcctccagctgcttgccagcaaagataaggcgctgctggtcc gggggaatgccctccttgtcctggatcttggccttgacgttgtcaatggt gtcggagctctcgacctccagggtgatggtcttgccagtgagggtcttca cgaatatctgcatgccaccacgcagacgcaggacaaggtggagggtggac tccttctggatgttgtagtcagcgagggtacggccatcctccagctgctt gccagcgaagatganacgctgctggtccggaggaatgccctccttgtcct ggatcttggccttgacattgtcnatggtgtcanacgactcaacctcaagg gtgatggtcttgcctgtcantgttttcacaaanatctgcatctgcaaana anaatcncatggaca
Download
page-top