Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ521968
Length 911 bp
Fasta Format > rwhcs4e18
acaggaatccaaccacattggtctcatttcatacgaagcaaataacactc agtagtaatactacgaatcaactcgatctaaggtccaaaaacctcacagg gcagatatgttatgcttgctttagctacgacaccatcacggcaacagaaa actgtagatatattgtgcgcccaccgccatcacctgcctcaggaagattt agattttgttgaaggcaacaatgtcacagctctggatgtactcgttggct ggttcaacgcagagatggtcttcaataagagtgtcgacagagacgaggtc atcaatgatggtcatcataatctggagcttcttgatgccatatccaacgg gcatgagcttggaagcaccccacagaaggccctccatcttgatgcttcgg acagcttcctccagcttgaccatgtcggtctcatcgtcccatggcttaac atcaagcaaaactgatgacttgccagattctttcttcttggtagaagcct ttgctttggcagcgcgctcttcagctgcctttttctcctcctcggtttcc tctccaaaaaggtcaacatcgctgtcatcgtcatcatcagctgcaggagc ctcagcaacatcagtagttgaggtttcagggacaactgatgacagaacct tcacaccttgaccaggggcagtaactccactcagcttcaggagtgcatca atgtgattgtaccaccttgcaacattggtgcaagttgatggtggagcaac tgagaactctgaatacacagccaagtcatccttggaagcttggtatccag agatgtaactgcgagacagaaggtagccatcaagctttttaaggcctgcc tcagcattaacattgaaggtagccgccatctcagcctcnaaaggatggaa cagatgatctc
Download
page-top