Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ521745
Length 877 bp
Fasta Format > rwhcs3g19
gcagcttaaagctacgtagtagacaggatcagcttgtacaagagcatgga gctcaggaatccttctcacacatcaacctattcctttgtaatattcacac gaggttaaacagtatgttcaagtctaaacacaggaaacctgccaaattaa catgtcatgtcaggctgcaggcgggactgatcgtgggcgtgacatgccag cgtgtgcaagtatgatacattttcccagtgattcgaagtcactcccatga atgaacagccacatcaaacagtatgcctaacatttctgaatccttaacct tcttggatcctcacacagtcaagcacgccaattgtcctttcctcacatcg atgaagccgagcttagttttgggcttcgaactcctgcttgctcatgaata ttgcaactggctccccaggggagcgcgggttgttgttcagcacagaaaca tgcagtccagctctggcacgagcagctccatcagatgccgacagcacctc tgcatgctcaaggcccagctgccttttgatcagctccaggttctcctcaa gcacgttcatttcaccaaaggggagcgtcaaattcaaagcctgcggaccg atggtccttgcttcatctttcttgaacctgatgaaaggcatgcagagctt ctggacttgtgtgaagtttgcttcatgttcaatgaagcaattcttcagcg cctcactaatatcctcatccggggcaaacaaacgtgcttggctatcataa cttgattgaagcaccctcaagcattgctctttccatccgtcatagtgctc gttgacatagatgagaccgacagtgagcttgttctctgcggccggangtg gtgcccgcgcccttcttggggtttctt
Download
page-top