Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ521718
Length 858 bp
Fasta Format > rwhcs3f04
ggtgtaacatatataggtagaattctggcattacaacatatagcggcaag aaaatactacagacaaatgatactaggtccactaggataatgggaaacac ggggatacagtcgtctagacacgcggcagttgcatcagaccattttgtgg ctcaaaaagtttctaatcgtcaccaaatgtggtcttcttccctgcgctag ctgtgccagcactctgtctgctctgaaagcctcggccgcctcctctgccg ccatcacggccaccagaccggccaaacctgccgccaccatcacggccacc agaccggccaaacctgccgccgccatcacggccaccagaccggccaaacc tgccaccaccagagcggccaccatctctgccaccagatcgaccaccaacg ccaccaaattgacccttaggcttagcttcagcaacatacaagttgcagcc acctaggtcagatccactaagctcaagtgctttcgaaaaggaactctcat cagtaaaatccatgtaagctatccctttgcttgcaccattctcataatcc atcggaactgagacacgtgtgatttctccacatttagagaagtgttcttg aagagagctccgaatagcatcctcctgttgagatgaatcaaaacccttga caaatactgagaggctgggacctccacttggttttccaaacgatccacca tccctggtgcgaggagttgcacctctttcagcagccatgtcaagtctcac cggacggcccattagatctccaccattcagtgaatcaagcgctttctgag catcttcagccgtagcaaactcaacatgaccaaatcccttgggatggcca tcttcatg
Download
page-top