Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ518905
Length 905 bp
Fasta Format > rwhcs12l04
attctggcattacaacatatagcggcaagaaaatactacagacaaatgat actaggtccactaggataatgggaaacacggggatacagtcgtctagaca cgcggcagttgcatcagaccattttgtggctcaaaaagtttctaatcgtc accaaatgtggtcttcttccctgcgctagctgtgccagcactctgtctgc tctgaaagcctcggccgcctcctctgccgccatcacggccaccagaccgg ccaaacctgccgccaccatcacggccaccagaccggccaaacctgccgcc gccatcacggccaccagaccggccaaacctgccaccaccagagcggccac catctctgccaccagatcgaccaccaacgccaccaaattgacccttaggc ttagcttcagcaacatacaagttgcagccacctaggtcagatccactaag ctcaagtgctttcgaaaaggaactctcatcagtaaaatccatgtaagcta tccctttgcttgcaccattctcataatccatcggaactgagacacgtgtg atttctccacatttagagaagtgttcttgaagagagctccgaatagcatc ctcctgttgagatgaatcaaaacccttgacaaatactgagaggctgggac ctccacttggttttccaaacgatccaccatccctggtgcgaggagttgca cctctttcagcagccatgtcaagtctcaccggacggcccattagatctcc accattcagtgaatcaagcgctttctgagcatcttcagccgtagcaaact caacatgaccaaatcccttgggatggccatcttcatgggtagccaggcga acatcaacgacctctccaatttgtgcaaaaaattgcttcacttgatcata ctcaa
Download
page-top