Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ518902
Length 828 bp
Fasta Format > rwhcs12k24
acacgaacaaaataagataactgaacgctggctaggaatgtcgacagaag tactcaagaaatcagccatcaaaactgactacaaagttcacgacacccag gtggcacatatatcatcttctagatatgaagcagcaaaatagcgacttct attttctactcagcagcagcaacctcctccgctccaggaatcacctcatc tccatcagcaggcctgtcaagcttcacaccaacatcctccttgtagtcac cgtgcacctccatgagcttccccaggtcaaacttgggggccttcaggatc ttcaccttgcggacgtacacgttctggagggggaagatgcttgaggtggc cttctcaatctcctttccaatcacctcagggatgaacttgttcacaagct ccttcaagtcacagcttgcagcttggttgaccatgatctcaaccatcttg cggcggatctgtctgatctgacttgcttgggcatagcaagtgcgcttcac ctggtttgggcgtctcttcgtgaagccaatggtgaacatgcggagcatgt agttgtcagtggtcttcacatccacatgagcctcaatgagtgtctgccac ttcctcacaagagacctgagcttgtcagtggtgaagtccatgccccagaa gtttgtgaggacattcatcccttgcacatcctcagcacggagtctgatct tcctgtaggcctggtcctcatcgttctgaagatcagctagagatacttcg aacaccctgtgcttcagaccctctgaggcaatcttggtaccctgtgtcct ggacacgagggtcttgccgacgttgcgg
Download
page-top