Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ518893
Length 865 bp
Fasta Format > rwhcs12k05
caagtgataggacatcccaatagcaatacagccacgactcaacagacaga aaataatagtgcagctctcttagcagcaaaggcaaactagacccatatga taacagaactaaaagtttagagcttgtcctcgaaatcagatagaggggtc atctgttccttcagacccttgcgcttgcggatctccgtgacaagggtcgc agactgggagccggcctccaaaggatccgaagacatgatgtcccagtggt cgaacacacactgggggaaagcctggccagatgtcgcagccctgagggta cttgagaacccgaacgactcgatgaccgggaggtaagccttgatgttgta cagcggggtaccaggcctctgcatctcctcaaacacgtgccctctcttct gattcagaacaccatagataccgccgagtgcattctccggggcctggatc tcaaccaggtacacaggctccagtagccttggcttagcagtgagctgaga agcataaatgaccctccgggctgttgggatgacctgaccaccacccctgt gaatagcatcagtgtgcagaacaacatcacagacctcaaagcagatgcca cgcatgttctcctcagccaatgcaccttccttcgatgcccactggaaccc agccacaacagagtccttgatttcattcagatactgcactcccttacaca tgtcgacaaccatgttgggcccagtcgtctcaggtccaaagcaccaaatc ttcttggcgagatccttgtcccaaccaaactcctcagataggatcttaga gcgcaccttaggatcatcacgtgggccaatgcggccatcatcaatagcct cagccnaatccctcc
Download
page-top