Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ518383
Length 915 bp
Fasta Format > rwhcs10k13
atatatagtagaattctggcattacaacatatagcggcaagaaaatacta cagacaaatgatactaggtccactaggataatgggaaacacggggataca gtcgtctagacacgcggcagttgcatcagaccattttgtggctcaaaaag tttctaatcgtcaccaaatgtggtcttcttccctgcgctagctgtgccag cactctgtctgctctgaaagcctcggccgcctcctctgccgccatcacgg ccaccagaccggccaaacctgccgccaccatcacggccaccagaccggcc aaacctgccgccgccatcacggccaccagaccggccaaacctgccaccac cagagcggccaccatctctgccaccagatcgaccaccaacgccaccaaat tgacccttaggcttagcttcagcaacatacaagttgcagccacctaggtc agatccactaagctcaagtgctttcgaaaaggaactctcatcagtaaaat ccatgtaagctatccctttgcttgcaccattctcataatccatcggaact gagacacgtgtgatttctccacatttagagaagtgttcttgaagagagct ccgaatagcatcctcctgttgagatgaatcaaaacccttgacaaatactg agaggctgggacctccacttggttttccaaacgatccaccatccctggtg cgaggagttgcacctctttcagcagccatgtcaagtctcaccggacggcc cattagatctccaccattcagtgaatcaagcgctttctgagcatcttcag ccgtagcaaactcaacatgaccaaatcccttgggatggccatcttcatgg gtagccaaggcgaacatcaacgacctctccaatttgtgcaaaaaattgct tcacttgatcatact
Download
page-top