Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ518302
Length 852 bp
Fasta Format > rwhcs10f20
aagagtacttgattagcaactccattacagatactagaggttgatgcgga aaacagaaggtaactcatgtccaactaacatgaaccaggcgtcgtctggc gacaccatccacatttattcttcgcatagacaaagcagggacacctctga ccaggcgccacaaacgaaagcagaacgctctactgagtcttggccatgtg gcggatcaggtcgacaacgcggttgctgtaaccccactcgttgtcatacc acgagacaagcttgacgaagtggtcgttcagagcaattccagccttggca tcaaagatgctcgacctgctgtcaccgacaaaatcagtggagaccaaatc ctcctcgacgtaacccatgatccccttgagttttccctcggatgcagcct tgatagccttcttgatgtcatcatatgatgcagccttctcggttctaaca gtgagatcaacaactgacacatccacagtgggaacccggaaagacatacc cgtaagcttgccattcagctcaggaagaaccttaccaacagccttggcag caccagtgctgctgggaatgatgttaaagcttgcggccctgccacctctc cagtccttgctcgagggaccatcaacggtcttctgtgtggcagtgatggc atgaacagtggtcatcaaaccctcaataataccgaagttgtcattaatga tcttagctaggggagcaaggcagttagtggtgcagctagcatttgagaca atgttaacgtctgaggtgtacttgtcctcattgacaccaaccacaaacat aggggcatctttgcttggggcagagatgaccaccttcttgggcaccaccc tt
Download
page-top