Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ518299
Length 895 bp
Fasta Format > rwhcs10f17
tcatcttttaatcccgtctatgtacaaatatttacagcgacaaaatcaac ttgcacttctacagcaagtatcttcatcacctcttccaccaaatgggcgg tcctaccttttgtattccaaatggctggtcaggggcaaatctccaaaaga cctacctacgtcacaagaacttgtctcacaaaatcagttgacatgtcagc ttcagtaactaacaattcaagcaccgctacgggccttgcctgcacatcaa ggcagccacagtattccgcgatcagcgcatcatgttaaaagctgctaagg atcatccactaccacctttgctacatggtctcatttttgtttcttcttag gcttctttgacgatataagagctgaggaaagtaaagactcaacgtcctcc ctttgacgcttcctcgctgcaatttggtccttttgactagttacagtttg cttagcagcttggcttgtcgtgaggtcccgtatatggctgcttgttccat caaaatgtgatgaaactgatggatccacctgattcgagttcccagatctt ggttgttcggtaaacttccttgcccccttgaccttatttttcttcatatc agggattgttggtggaccagtaccactgttcctatttgctaattccgaaa ctgcgtcatctttaagcaaggaaccctctttgtttgaattactgaacctt ggtgtttcagaaaacttccttgctcctttagccttttgtatcaaattctg catttcacagtgttgtgctgatgaagaaccatcatcctgcttggccactg attttacaacagaatcatgttttgacgaacccttgatggttcccatatca ttgttttggttggcagcctttttgtcgnaattatgtaatctcacc
Download
page-top