Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ518298
Length 800 bp
Fasta Format > rwhcs10f16
acggtaagatagcagcagacacaggaagataaccaaggccgccggacgca gatccagcggcccaaagagtccacctaaaaccctcctaaaccaaccacgg agatctcatcggacggaccaggggaagacacgacacacgactctcttatt tagatcgacgacacgacacgggacacacggggcgatgacgacgacggcga ccggcgggcgggcggatctagagctggccgcagtcggcgatgacgacctg cttggagcaggtgccgctgcgggagcccaccttctcgatgttcttgacga cgtccatgccctcgacgacctcgccgaagaccacgtgcttgccgtcgagc caattgcaggggacggtgcagatgaagaactgggagccgttggtgttggg cccggcgttggccatggagaggatcccgggcttggtgtgcttgtggacga acttctcgtcggcgaacttctcgccgtagatggactcgcctccggtgccg ttgcccctggtgaagtcgccgccctggcacatgaagtcggggatcacgcg gtggaaggcgctgcccttgtagtgcagcggcttgccgctcttgccgacgc ccttctcgccggtgcanagcgcgcggaanttctccaccgtccgcggcacc gcgtccttgtacagctccatcacnatgcnccccnccggcgcgccnccnac ggtcatgtcnaanaacaccctcngnttgnccatctcnctcnccngnatcn nngatnanggctangnttttnanatnnnnatttntntnnnnattnnatta
Download
page-top